View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10707_low_87 (Length: 201)

Name: NF10707_low_87
Description: NF10707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10707_low_87
NF10707_low_87
[»] chr3 (1 HSPs)
chr3 (15-185)||(10797082-10797252)


Alignment Details
Target: chr3 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 15 - 185
Target Start/End: Complemental strand, 10797252 - 10797082
Alignment:
15 agagaagaggcaatgctggttttggctgaggttggaaggtcaatggagagttttccggcggatttggctgttgctgttaaggcagggagggtgccgggtt 114  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
10797252 agagaagaggcaatgctggttttagctgaggttggaaggtcaatggagagttttccggtggatttggctgttgctgttaaggcagggagggtgccgggtt 10797153  T
115 cgatagtgaggaggttttttgagttggaggagtcagttgttttcagatggttgttaaaatttggagggttt 185  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
10797152 cgatagtgaggaggttttttgagttggaggagtcagttgttttccgatggttgttaaaatttggagggttt 10797082  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University