View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10707_low_87 (Length: 201)
Name: NF10707_low_87
Description: NF10707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10707_low_87 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 15 - 185
Target Start/End: Complemental strand, 10797252 - 10797082
Alignment:
| Q |
15 |
agagaagaggcaatgctggttttggctgaggttggaaggtcaatggagagttttccggcggatttggctgttgctgttaaggcagggagggtgccgggtt |
114 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10797252 |
agagaagaggcaatgctggttttagctgaggttggaaggtcaatggagagttttccggtggatttggctgttgctgttaaggcagggagggtgccgggtt |
10797153 |
T |
|
| Q |
115 |
cgatagtgaggaggttttttgagttggaggagtcagttgttttcagatggttgttaaaatttggagggttt |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
10797152 |
cgatagtgaggaggttttttgagttggaggagtcagttgttttccgatggttgttaaaatttggagggttt |
10797082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University