View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10709_low_1 (Length: 436)
Name: NF10709_low_1
Description: NF10709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10709_low_1 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 234; Significance: 1e-129; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 172 - 421
Target Start/End: Original strand, 22276624 - 22276873
Alignment:
| Q |
172 |
aacttggttaattctactaacttttgtttaacaacatttatttactaatttttgtttaattaattagttggctttatcggattaaaccttcggtgactca |
271 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22276624 |
aacttggataattctactaacttttgtttaacaacattaatttactaatttttgtttaattaattagttggctttatcggattaaaccttcggtgactca |
22276723 |
T |
 |
| Q |
272 |
cgaaccgttcaaggcacgggttccttcaaataagaaaattttgagtgagttcaatgactcaaacagttctacaaatccaactcagcttcgatggaaacca |
371 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22276724 |
cgaaccgttcaaggcacgggttccttctaataagaaaattttgagcgagttcaatgactcaaacagttctacaaatccaactcagcttcgatggaaacca |
22276823 |
T |
 |
| Q |
372 |
acagatatacctgattcaccaacggatttcattgatgggttattcaccgt |
421 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22276824 |
acagatatacctgattcaccaacggatttcattgatgggttattcaccgt |
22276873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 103 - 139
Target Start/End: Original strand, 14666115 - 14666151
Alignment:
| Q |
103 |
gcttgtgcgtggaggcatgcgcactggccaaatgttg |
139 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
14666115 |
gcttgtgcgtagaggcatgcgcactggccaagtgttg |
14666151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 107 - 139
Target Start/End: Complemental strand, 3353485 - 3353453
Alignment:
| Q |
107 |
gtgcgtggaggcatgcgcactggccaaatgttg |
139 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |
|
|
| T |
3353485 |
gtgcgtagaggcatgcgcactggccaaatgttg |
3353453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University