View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10709_low_5 (Length: 214)
Name: NF10709_low_5
Description: NF10709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10709_low_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 11 - 199
Target Start/End: Original strand, 33927787 - 33927975
Alignment:
| Q |
11 |
agcagagacatgggataacaaatttccctcttacctactcctggggaacgagaaattaaaccataatcaatatcctaactagaactatcatcattactgt |
110 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
33927787 |
agcaaagacatgggataacaaatttccctcttacctactcctggggaacgagaaattaaaccacaatcaatatcctagctagaactatcatcattactgt |
33927886 |
T |
 |
| Q |
111 |
cagaatcactcgaaatctctcccaacggtaaatgtctataataacccatttcgaagacaacctgtttgtaactccaatccagatgtttt |
199 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33927887 |
cagaatcactcgaaatctctcccaatagtaaatgtctataataacccatttcgaagacaacctgtttgtaactccaatccagatgtttt |
33927975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University