View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1070_low_5 (Length: 278)
Name: NF1070_low_5
Description: NF1070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1070_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 96; Significance: 4e-47; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 11 - 110
Target Start/End: Complemental strand, 33246060 - 33245961
Alignment:
| Q |
11 |
cacagacacaatcttcacaacccatcaacccatttttgtcaaagaaggttttcaaggctgaaagggacaaccttggagagggtatgatcactgtttcatc |
110 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33246060 |
cacaggcacaatcttcacaacccatcaacccatttttgtcaaagaaggttttcaaggctgaaagggacaaccttggagagggtatgatcactgtttcatc |
33245961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 161 - 249
Target Start/End: Complemental strand, 33245910 - 33245822
Alignment:
| Q |
161 |
gaatggttctgttaggtaatcttatgtgatgatcttcatagttttcaacaattttatggtgaaagtttcaatttttaagggtttagtga |
249 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33245910 |
gaatggttctgttaggtaatcttatatgatgatcttcatagttttcaacacttttatggtgaaagtttcaatttttaagggtttagtga |
33245822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 196 - 244
Target Start/End: Original strand, 13567251 - 13567299
Alignment:
| Q |
196 |
tcatagttttcaacaattttatggtgaaagtttcaatttttaagggttt |
244 |
Q |
| |
|
|||||| |||||||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
13567251 |
tcataggtttcaacacttttatgctgaaagcttcaatttttaagggttt |
13567299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 196 - 244
Target Start/End: Original strand, 19138314 - 19138362
Alignment:
| Q |
196 |
tcatagttttcaacaattttatggtgaaagtttcaatttttaagggttt |
244 |
Q |
| |
|
|||||| |||||||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
19138314 |
tcataggtttcaacacttttatgctgaaagcttcaatttttaagggttt |
19138362 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 196 - 244
Target Start/End: Original strand, 23961565 - 23961613
Alignment:
| Q |
196 |
tcatagttttcaacaattttatggtgaaagtttcaatttttaagggttt |
244 |
Q |
| |
|
||||| ||||||||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
23961565 |
tcataattttcaacacttttatgctgaaagcttcaatttttaagggttt |
23961613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 196 - 244
Target Start/End: Complemental strand, 24560438 - 24560390
Alignment:
| Q |
196 |
tcatagttttcaacaattttatggtgaaagtttcaatttttaagggttt |
244 |
Q |
| |
|
|||||| |||||||| ||||||| |||| | |||||||||||||||||| |
|
|
| T |
24560438 |
tcataggtttcaacacttttatgctgaacgcttcaatttttaagggttt |
24560390 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University