View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1070_low_8 (Length: 251)
Name: NF1070_low_8
Description: NF1070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1070_low_8 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 44 - 251
Target Start/End: Original strand, 5664704 - 5664911
Alignment:
| Q |
44 |
tttcatcgaattcacaacactttggtaggaaagtagcacacaataagcgccatatataaacaccaaatgcaaaataaaatcagcccctcaaccatctcac |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5664704 |
tttcatcgaattcacaacactttggtaggaatgtagtacacaataagcgccatatataaacaccaaatgcaaaataaaatcagcccctcaaccatctcac |
5664803 |
T |
|
| Q |
144 |
ttttctctggagctaactcaagaactagatatttttcaacgggatcatgaagagatggatgtggggaagctgattgcttacaacattaaggatatagtct |
243 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
5664804 |
ttttctctgtagctaactcaagaactagatatttttcaacgggatcatgaagagatggatgtggggaagctgattgcttacaacattaaggatatgttct |
5664903 |
T |
|
| Q |
244 |
ccaccaaa |
251 |
Q |
| |
|
|||||||| |
|
|
| T |
5664904 |
ccaccaaa |
5664911 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University