View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10710_high_18 (Length: 228)
Name: NF10710_high_18
Description: NF10710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10710_high_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 17470106 - 17469883
Alignment:
| Q |
1 |
cccatttcaaagatgctatacaaggtgcagtgcaagtagatttatagagcatttggtgtgaacatagtgatttatttaatgg-tcttgaatattcgacgt |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||| |||||||||||||| || |
|
|
| T |
17470106 |
cccatttcaaagatgctatacaaggtgcagtgcaagtagatttatagagcagtttgtgtgaacatagtgatttatttaatgggtcttgaatattcgatgt |
17470007 |
T |
|
| Q |
100 |
acaagaattaatttttctcttcaaaaagacttagcggtgcagtttgttgcctgcaccttccactcatgtgtaattttcggtatataaagggttttaaact |
199 |
Q |
| |
|
|| |||||| ||||||| ||| |||||| |||||||| |||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17470006 |
acgagaattgatttttccctttaaaaaggtttagcggtacagtttgttgtccgcaccttccactcatgtgtaattttcggtatataaagggttttaaact |
17469907 |
T |
|
| Q |
200 |
aagcataaaaattccttatattct |
223 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
17469906 |
aagcataaaaattccttatattct |
17469883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University