View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10710_high_19 (Length: 227)
Name: NF10710_high_19
Description: NF10710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10710_high_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 11492253 - 11492477
Alignment:
| Q |
1 |
agtccaagtcaatagaaaaacttttataaatccaaccttgagagatttaaacacatgcaaatctttatgttttgaaatttctgaaaatttatggggatta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11492253 |
agtccaagtcaatagaaaaacttttataaatccaaccttgagagatttaaacacacgcaaatctttatgttttgaaatttctgaaaatttatggggatta |
11492352 |
T |
 |
| Q |
101 |
ctcatcaaaccattttgtaatatcagagaaataatcttgtttctatcaaaaacaaaaacat----atacctctaatcattggtttccggcatccaaaggg |
196 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||| ||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
11492353 |
ctcatcaaaccattttgtaatataagagaaataatcttgtttttatcaaaaacaaaaacatatacatacctctaatcattggttgccgacatccaaaggg |
11492452 |
T |
 |
| Q |
197 |
atcatccacgatatcttcttctcac |
221 |
Q |
| |
|
|||||||||||||||||| |||||| |
|
|
| T |
11492453 |
atcatccacgatatcttcatctcac |
11492477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 170 - 212
Target Start/End: Complemental strand, 39343066 - 39343024
Alignment:
| Q |
170 |
aatcattggtttccggcatccaaagggatcatccacgatatct |
212 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
39343066 |
aatcactggttgccggcatccaaagggatcatccatgatatct |
39343024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University