View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10710_high_21 (Length: 205)
Name: NF10710_high_21
Description: NF10710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10710_high_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 23 - 166
Target Start/End: Original strand, 30414279 - 30414422
Alignment:
| Q |
23 |
gactctatagacctgtttgcaccttcccatagccagccttggatatcatatatagtagtgataagaataagaaacgacaatatctcttgaattcatcctc |
122 |
Q |
| |
|
|||||||||||||||||||||||| ||||| | | | ||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30414279 |
gactctatagacctgtttgcacctccccatggtcggtcttagatatcatatataatagtgataagaataagaaacgacaatatctcttgaattcatcctc |
30414378 |
T |
 |
| Q |
123 |
ttaagattgatttgatacttttgaatgtctcatttttaatcaat |
166 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
30414379 |
ttaagatttatttgatacttttgaatgtctcacttttaatcaat |
30414422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University