View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10710_high_4 (Length: 378)
Name: NF10710_high_4
Description: NF10710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10710_high_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 300; Significance: 1e-168; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 300; E-Value: 1e-168
Query Start/End: Original strand, 3 - 362
Target Start/End: Original strand, 3088182 - 3088542
Alignment:
| Q |
3 |
tgaggatatgtgtgttgcaggagctatcaaaaatttcacttctcaactttctcattacaaagagggaacatctgatcgtagatgtaaggaactcatgtct |
102 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3088182 |
tgaggacatgtgtgttgcaggagctatcaaaaatttcacttctcaactttctcattacaaagagggaacatctgatcgtagatgtaaggaactcatgtct |
3088281 |
T |
 |
| Q |
103 |
gtcatttattttccctttcagaaatttttagacttattttacttcatgatattaattactggagattttgttnnnnnnnnnnn-taccattaactggaga |
201 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
3088282 |
gtcattttttttccctttcagaaatttttagacttattttacttcatgatattaattactggagattttgttaaaaaaaaaaaatactattaactggaga |
3088381 |
T |
 |
| Q |
202 |
tattgcagataatatgaccgaggcattattgttcttgtcacacttcatgggagatattcaccaggtttgtctaaagatttttaaaatttcttttatcata |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3088382 |
tattgcagataatatgaccgaggcattattgttcttgtcacacttcatgggagatattcaccaggtttgtctaaagatttttaaaatttcttttatcata |
3088481 |
T |
 |
| Q |
302 |
ttactccctttgtcttatcatagatatctttcattttgtatcagccgatgcacgttggatt |
362 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3088482 |
ttactccctttgtcttatcatagatatctttcatttcatatcagccgatgcacgttggatt |
3088542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University