View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10710_low_23 (Length: 268)
Name: NF10710_low_23
Description: NF10710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10710_low_23 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 17 - 254
Target Start/End: Complemental strand, 14658863 - 14658628
Alignment:
| Q |
17 |
cttataagtctaacttcttatgtgaaactctccaattatatgtgacccaagagtaaccagcagcaacgtaaatgtatttacactgaaatcaattttgtag |
116 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||| || ||||||||||||||||||||| ||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
14658863 |
cttacaagtcttacttcttatgtgaaactctccaataat--gtgacccaagagtaaccagcaacaatgtaaatgtatttatactgaaatcaattttgtag |
14658766 |
T |
|
| Q |
117 |
aatcaagatcatgtaaaatcaaatttataaacatacataatggtttttagctaaaaggaatatcaattaggtcagaagtaacttagtgctatgatcatcg |
216 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||||||||| ||||||||||||| ||||||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
14658765 |
aatcaagatcatgcaaaatcaaatttataagcatacataatgatttttagctaaaaagaatatcaattaggtcaaaagtaacttagtactatgatcatcg |
14658666 |
T |
|
| Q |
217 |
aatatgtgccctttgtttctaacaacactggttggaga |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14658665 |
aatatgtgccctttgtttctaacaacactggttggaga |
14658628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University