View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10710_low_24 (Length: 268)
Name: NF10710_low_24
Description: NF10710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10710_low_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 16 - 257
Target Start/End: Original strand, 42352050 - 42352291
Alignment:
| Q |
16 |
atttaggactcagtagaatagagtaaatagtaatacatgattggtaggaaagaatgggcgtggtaatctattgtgtagtgtgaggagaaataggcctcag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42352050 |
atttaggactcagtagaatagagtaaatagtaatacatgattggtaggaaagaatgggcgtggtaatctattgtgtagtgtgaggagaaataggcctcag |
42352149 |
T |
 |
| Q |
116 |
tattccataaaggggttatctatttggctcattgtgaagctgtgctcttttctacgtgccttttctatggtagtattcaagtgtttgatctgagttatca |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
42352150 |
tattccataaaggggttatctatttggctcattgtgaagctgtgctcttttctacgtgccttttctgtggtagtattcaagtgtttgatctgagttatca |
42352249 |
T |
 |
| Q |
216 |
tacctttatactttatcatgaattgtttatctgtccattcat |
257 |
Q |
| |
|
|| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
42352250 |
tagctttatactttatcatgcattgtttatctgtccattcat |
42352291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University