View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10711_high_12 (Length: 251)
Name: NF10711_high_12
Description: NF10711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10711_high_12 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 12 - 251
Target Start/End: Complemental strand, 9374209 - 9373970
Alignment:
| Q |
12 |
atagggaaagttttcggctatatgcctcttgatttttgtaagaaatgatcatgatcattgaattttcttcctttagatgatttttaaaccaattcagccg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
9374209 |
atagggaaagttttcggctatatgcctcttgatttttgtaagaaatgatcatgatcattgaattttcttcctttagataatttttaaaccaattcagccg |
9374110 |
T |
|
| Q |
112 |
taatatattacttcatacccttgtagtggaaaaatgatgataaggaataaaagttgccgttccatctttaaaggattgtgtttcttgacttcacttcaat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9374109 |
taatatattacttcatacccttgtagtggaaaaatgatgataaggaataatagttgccgttccatctttaaaggattgtgtttcttgacttcacttcaat |
9374010 |
T |
|
| Q |
212 |
ttgatatatggtatcattgattggtgacaaaggaactaac |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9374009 |
ttgatatatggtatcattgattggtgacaaaggaactaac |
9373970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University