View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10711_low_20 (Length: 250)
Name: NF10711_low_20
Description: NF10711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10711_low_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 14261381 - 14261622
Alignment:
| Q |
1 |
ttgaaattgagatttgtgatgaaaatggtgaatgtgattgtgttatttatatgtgtgtattggagattgaggaagaagaggtttgagaattggatttgat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
14261381 |
ttgaaattgagatttgtgatgaaaatggtgaatgtgattgtgttatttatatgtgtgtattggagattgaggaagaataggtttgagaattggatttgat |
14261480 |
T |
 |
| Q |
101 |
ttgagccgttggatttggagtaatcgatggtttagattatgatccgtgtgaagctaagtgagagattttggaccgttgataaatatgtatgaacggttgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14261481 |
ttgagccgttggatttggagtaatcgatggtttagattgtgatccgtgtgaagctaagtgagagattttggaccgttgataaatatgtatgaacggttgg |
14261580 |
T |
 |
| Q |
201 |
attttgatttgtagtggatttgcggatcgcgctgcctttgct |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
14261581 |
attttgatttgtagtggatttgcggatcgcacttcctttgct |
14261622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University