View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10711_low_21 (Length: 241)
Name: NF10711_low_21
Description: NF10711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10711_low_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 6 - 225
Target Start/End: Original strand, 35088255 - 35088474
Alignment:
| Q |
6 |
aggagcagagaatatattaaagtcgtgtttttatctaatttgggaaaataaatagagataacctgtctaagagtctttttattttattgataaaaaaggc |
105 |
Q |
| |
|
|||| |||| || ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
35088255 |
aggaccagaaaacatattaaagtcgtgtttttatctaatttgggaaaataaatagagataacgtgtctaagagtctttttattttattgataaaaaaggt |
35088354 |
T |
 |
| Q |
106 |
agtgtatcaataatattatgaagacaaatgctagctagagctcaaagtatacagttaatgaaataaaaatggaatcaattggattgagtctatgaaaatg |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35088355 |
agtgtatcaataatattatgaagacaaatgctagctagtgctcaaagtatacagttaatgaaataaaaatggaatcaattggattgagtctatgaaaatg |
35088454 |
T |
 |
| Q |
206 |
gctaaatttcgtgacgaaat |
225 |
Q |
| |
|
||||||||| |||||||||| |
|
|
| T |
35088455 |
gctaaatttggtgacgaaat |
35088474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University