View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10711_low_25 (Length: 223)
Name: NF10711_low_25
Description: NF10711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10711_low_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 9 - 204
Target Start/End: Original strand, 33107442 - 33107637
Alignment:
| Q |
9 |
gagtgagaagaagggtggatgatgaagagaagctggtggaagagaaggcattttcgaggcacgggaaggggaagttgtctccggtggcggttgcggaggc |
108 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
33107442 |
gagtgagaagtagggtggatgatgaagagaagctggtggaagagaaggcattttcgaggcacgggaaggggaagttgtctccggtggcagttgcggaggc |
33107541 |
T |
 |
| Q |
109 |
ggcggaaatggcggctcaagggatggggtttgaagtggtgtattatccgagagcagggtggtcggattttgtgttgaaagcggaagttgtggatgc |
204 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
33107542 |
ggcggaaatggcggctcaggggatggggtttgaagtggtgtattatccgagagcagggtggtcggattttgtgttgaaagcggaggttgtggatgc |
33107637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University