View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10711_low_6 (Length: 359)
Name: NF10711_low_6
Description: NF10711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10711_low_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 151; Significance: 8e-80; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 151; E-Value: 8e-80
Query Start/End: Original strand, 134 - 342
Target Start/End: Original strand, 5996920 - 5997129
Alignment:
| Q |
134 |
aacattacatcaaacttaaaactttacggtatgacatcaaatatctatcgacaattttggcacttacagttcgaatgaactcaaagatagagcgtattat |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
5996920 |
aacattacatcaaacttaaaactttacggtatgacatcaaatatctaccgacaattttggcacttacaattcgaatgaactcaaagattgagcgtattat |
5997019 |
T |
|
| Q |
234 |
cttcaaccaacc-nnnnnnnnncatcgatactacgctcacaatcatctcaggatgataaacagtaattcatttgtcgttatcataccatggatctttcag |
332 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
5997020 |
cttcaaccaaccaaaaaaaaaacatggatactacgctcacaatcatctaaggatgataaacagtaattcatttgtcgttatcataccatggatctttaag |
5997119 |
T |
|
| Q |
333 |
tggtacatgt |
342 |
Q |
| |
|
|||||||||| |
|
|
| T |
5997120 |
tggtacatgt |
5997129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 9 - 75
Target Start/End: Original strand, 5996850 - 5996918
Alignment:
| Q |
9 |
taatttaaatgcaca--gatgacataaaactgcatgtctagatatctctaagtcaaaaccaccgtttaa |
75 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
5996850 |
taatttaaatgcacaacgatgacataaaactgcatgtctagatatctctaagtcaaaaacaccgtttaa |
5996918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University