View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10711_low_8 (Length: 341)
Name: NF10711_low_8
Description: NF10711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10711_low_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 231; Significance: 1e-127; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 68 - 335
Target Start/End: Complemental strand, 25550578 - 25550315
Alignment:
| Q |
68 |
agaggagggttttgtaatcatacgccgttgatggtgtcctgcatacaccaaaagatgaacaaacaagtctcttatcgctttccttgagtcgtccggataa |
167 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
25550578 |
agaggagggttttgtaatcatacaccgttgatggtgtcctgcatacaccaaaagatgaacaaacaagtctcgtatcgctttccttgagtcgtccggataa |
25550479 |
T |
|
| Q |
168 |
aaggacaataaaagtcgctccctccctcagactaggcaggttgtacctctgctgtcgtcagagagctcttggggaagaggcattaggataagttgctaaa |
267 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
25550478 |
aaggacaataaaagtcgctccctc----agaataggcaggttgtacctctgctgtcgtcagagagctcttggggaagagccattaggataagttgctaaa |
25550383 |
T |
|
| Q |
268 |
ataagtgggattgattgtcccatcttgttgggtgtggagaagcattaggaatttccatttcttctctc |
335 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
25550382 |
ataagtgggattgattgtcccatcttgttgggtgtggagaagcattaggaatttccatttcttttctc |
25550315 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 21 - 106
Target Start/End: Complemental strand, 25550669 - 25550583
Alignment:
| Q |
21 |
actgcatacgtcaaaagacaaataaatcttgtctatcaaaatctgaaagaggagggttttgtaatcatacg-ccgttgatggtgtcc |
106 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
25550669 |
actgcatacgtcaaaagacaaacaaatcttgtctatcaaaatctgaaagaggagggttttgtaatcatacgaccgttgatggtgtcc |
25550583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University