View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10712_low_2 (Length: 210)
Name: NF10712_low_2
Description: NF10712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10712_low_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 10 - 193
Target Start/End: Complemental strand, 31703629 - 31703446
Alignment:
| Q |
10 |
aagcaaaggaatattgcaatatagaagagaaataaaatggcatagtttaacatattggagaagtgaagtgtgaaaatggaaatggaagtaaccacattgt |
109 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
31703629 |
aagcaatggaatattgcaatatagaagagaaacaaaatggcatagtttaacatattggagaagtgaagtgtgaaaatgaaaatggaagtaaccacattgt |
31703530 |
T |
 |
| Q |
110 |
tgctttatgtattggaaatcattgtctttttgcgccctacggaaagacaatgaagctcaagaacatcactttcacttgacacat |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31703529 |
tgctttatgtattggaaatcattgtctttttgcgccctacggaaagacaatgaagctcaagaacatcactttcacttgacacat |
31703446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University