View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10713_low_4 (Length: 234)
Name: NF10713_low_4
Description: NF10713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10713_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 16 - 219
Target Start/End: Complemental strand, 45277337 - 45277134
Alignment:
| Q |
16 |
aagaatctgtttatcatacatacagttgactatacctattggtttagcttttatttatgaaagaatattgatattccattctctgttagtccaaattcga |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45277337 |
aagaatctgtttatcatacatacagttgactatacctattggtttagcttttatttatgaaagaatattgatattccattctctgttagtccaaattcga |
45277238 |
T |
 |
| Q |
116 |
ttctccaactactttacaaaacaagaaaataaatttctatatttattcacaaaaagtgattaggcaaattcatccctaaaagcgccggtatcaatcaaaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45277237 |
ttctccaactactttacaaaacaagaaaataaatttctatatttattcacaaaaagtgattaggcaaattcatccctaaaagcgccggtatcaatcaaaa |
45277138 |
T |
 |
| Q |
216 |
tagt |
219 |
Q |
| |
|
|||| |
|
|
| T |
45277137 |
tagt |
45277134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University