View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10714_low_7 (Length: 240)
Name: NF10714_low_7
Description: NF10714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10714_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 17 - 238
Target Start/End: Original strand, 28035353 - 28035574
Alignment:
| Q |
17 |
aggaatttgcaccatttgttccccaaagtaaactagttgaatgagatgcttagcaccacctgcttctataatagcattgcaatgagtctcatgtagatag |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28035353 |
aggaatttgcaccatttgttccccaaagtaaactagttgaatgagatgcttagcaccacctgcttctataatagcattgcaatgagtctcatgtagatag |
28035452 |
T |
|
| Q |
117 |
ttatcagtctcagcaaatttgatgagagcttttgatgcttccgtagaaatcaccggttctgtttcatcgagcaacttcaccaatggcgcaatgaatcttg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28035453 |
ttatcagtctcagcaaatttgatgagagcttttgatgcttccgtagaaatcaccggttctgtttcatcgagcaacttcaccaatggcgcaatgaatcttg |
28035552 |
T |
|
| Q |
217 |
tttcagttgctctaaaagtcct |
238 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
28035553 |
tttcagttgctctaaaagtcct |
28035574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University