View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10714_low_8 (Length: 240)
Name: NF10714_low_8
Description: NF10714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10714_low_8 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 107 - 240
Target Start/End: Original strand, 43163259 - 43163392
Alignment:
| Q |
107 |
gattgcaaacttgaggtcttttagttatgaaattgcatgcttacatttctttattatcctgttcgattttctgttgaaggcattgatagattatatctta |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
43163259 |
gattgcaaacttgaggtcttttagttatgaaattgcatgcttacatttctttattatcctgttcgattttctgtcgaaggcattgatagattatatctta |
43163358 |
T |
 |
| Q |
207 |
tgtacaatttaaaatttgagtatattgtgtatat |
240 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
43163359 |
tgtacaatttagaatttgagtatattgtgtatat |
43163392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 84; Significance: 5e-40; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 17 - 201
Target Start/End: Original strand, 51464015 - 51464201
Alignment:
| Q |
17 |
actgatgactgcttcttggtaccaggtgaagaaaattgtcatgcatgc--tgcttgatgtgattgaaaaattagagaaagcaaggttagtgtgattgcaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| | | ||||| ||||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
51464015 |
actgatgactgcttcttggtaccaggtgaagaaaattgccgtacatgctatgcttgatgtggttgaaaaattagagaaagcaaggtta--gtgattgcaa |
51464112 |
T |
 |
| Q |
115 |
acttgag--gtcttttagttatgaaattgcatgcttacatttctttattatcctgttcgattttctgttgaaggcattgatagattata |
201 |
Q |
| |
|
|||| || || |||| |||||| ||||| || ||||||||||||||||| |||||| ||| ||| ||||||||||||||||||| |
|
|
| T |
51464113 |
acttcaggcgtttttttgttatggaattgtatacttacatttctttattaaactgttccctttgttgtcaaaggcattgatagattata |
51464201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University