View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10714_low_8 (Length: 240)

Name: NF10714_low_8
Description: NF10714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10714_low_8
NF10714_low_8
[»] chr5 (1 HSPs)
chr5 (107-240)||(43163259-43163392)
[»] chr1 (1 HSPs)
chr1 (17-201)||(51464015-51464201)


Alignment Details
Target: chr5 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 107 - 240
Target Start/End: Original strand, 43163259 - 43163392
Alignment:
107 gattgcaaacttgaggtcttttagttatgaaattgcatgcttacatttctttattatcctgttcgattttctgttgaaggcattgatagattatatctta 206  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
43163259 gattgcaaacttgaggtcttttagttatgaaattgcatgcttacatttctttattatcctgttcgattttctgtcgaaggcattgatagattatatctta 43163358  T
207 tgtacaatttaaaatttgagtatattgtgtatat 240  Q
    ||||||||||| ||||||||||||||||||||||    
43163359 tgtacaatttagaatttgagtatattgtgtatat 43163392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 84; Significance: 5e-40; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 17 - 201
Target Start/End: Original strand, 51464015 - 51464201
Alignment:
17 actgatgactgcttcttggtaccaggtgaagaaaattgtcatgcatgc--tgcttgatgtgattgaaaaattagagaaagcaaggttagtgtgattgcaa 114  Q
    |||||||||||||||||||||||||||||||||||||| | | |||||  ||||||||||| ||||||||||||||||||||||||||  ||||||||||    
51464015 actgatgactgcttcttggtaccaggtgaagaaaattgccgtacatgctatgcttgatgtggttgaaaaattagagaaagcaaggtta--gtgattgcaa 51464112  T
115 acttgag--gtcttttagttatgaaattgcatgcttacatttctttattatcctgttcgattttctgttgaaggcattgatagattata 201  Q
    |||| ||  || |||| |||||| ||||| || |||||||||||||||||  ||||||  |||  |||  |||||||||||||||||||    
51464113 acttcaggcgtttttttgttatggaattgtatacttacatttctttattaaactgttccctttgttgtcaaaggcattgatagattata 51464201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University