View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10715_high_6 (Length: 237)
Name: NF10715_high_6
Description: NF10715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10715_high_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 5 - 224
Target Start/End: Complemental strand, 42924112 - 42923893
Alignment:
| Q |
5 |
tatagacattgtgcacaagacccaaatcccattagaacttggtgggccagctagggcccatatacacaacttggaatatccttgaacatggggaccagtt |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
42924112 |
tatagacattgtgcacaagacccaaatcccattagaacttggtgggccagctagggcccatatacacaacttggaatatccttgaacatgggggccagtt |
42924013 |
T |
|
| Q |
105 |
ggattgaaaagaccccaagcgtccgagtcatgcccctggctatgcctagctagacaatcttgattaatgattaattatatcactcttcactacaattcaa |
204 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42924012 |
ggatagaaaagaccccaagcgtccgagtcatgcccctggctatgcctagctagacaatcttgattaatgattaattatatcactcttcactacaattcaa |
42923913 |
T |
|
| Q |
205 |
acaacatacatcacataaat |
224 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
42923912 |
acaacatacatcacataaat |
42923893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University