View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10715_low_5 (Length: 241)
Name: NF10715_low_5
Description: NF10715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10715_low_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 47 - 211
Target Start/End: Original strand, 47117006 - 47117170
Alignment:
| Q |
47 |
tcgatcaccttttaacgattatttttaatttcttgttttgtagatggataggcggagaatgtatgataggcaacaaagctcaacgggaacgccaacatca |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47117006 |
tcgatcaccttttaacgattatttttaatttcttgttttgtagatggataggcggagaatgtatgataggcaacaaagctcaacgggaacgccaacatca |
47117105 |
T |
 |
| Q |
147 |
ccatcttcgccggtgatgatgtcgccattgaaccgacatgctcgtgcaggttccacaggttctgc |
211 |
Q |
| |
|
|| ||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
47117106 |
ccgtcttcaccggtgatgatgtcgccattgaatcgacatgctcgtgcaggttccacaggttctgc |
47117170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University