View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10715_low_7 (Length: 238)
Name: NF10715_low_7
Description: NF10715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10715_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 84 - 172
Target Start/End: Complemental strand, 42929928 - 42929840
Alignment:
| Q |
84 |
agtttctgaactttaatcaatatgtgcaaatttgttgtgaaccctctccactgaattaacagcagcattgcactggccattagatttct |
172 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| || |||| |||||| ||| || |||||||||||||||| |
|
|
| T |
42929928 |
agtttctgaactttaatcaatatgtgcaaatttgttgtgaaccctctcctcttaattgacagcatcatcacattggccattagatttct |
42929840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 84 - 172
Target Start/End: Original strand, 16104441 - 16104528
Alignment:
| Q |
84 |
agtttctgaactttaatcaatatgtgcaaatttgttgtgaaccctctccactgaattaacagcagcattgcactggccattagatttct |
172 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| ||||||| || |||| |||||| ||| || ||| |||||||||||| |
|
|
| T |
16104441 |
agtttctaaactttaatcaatatgtgcaaatttgttgtgaa-cctctcctcttaattgacagcatcatcacattggtcattagatttct |
16104528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University