View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10715_low_8 (Length: 237)

Name: NF10715_low_8
Description: NF10715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10715_low_8
NF10715_low_8
[»] chr7 (1 HSPs)
chr7 (5-224)||(42923893-42924112)


Alignment Details
Target: chr7 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 5 - 224
Target Start/End: Complemental strand, 42924112 - 42923893
Alignment:
5 tatagacattgtgcacaagacccaaatcccattagaacttggtgggccagctagggcccatatacacaacttggaatatccttgaacatggggaccagtt 104  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
42924112 tatagacattgtgcacaagacccaaatcccattagaacttggtgggccagctagggcccatatacacaacttggaatatccttgaacatgggggccagtt 42924013  T
105 ggattgaaaagaccccaagcgtccgagtcatgcccctggctatgcctagctagacaatcttgattaatgattaattatatcactcttcactacaattcaa 204  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42924012 ggatagaaaagaccccaagcgtccgagtcatgcccctggctatgcctagctagacaatcttgattaatgattaattatatcactcttcactacaattcaa 42923913  T
205 acaacatacatcacataaat 224  Q
    ||||||||||||||||||||    
42923912 acaacatacatcacataaat 42923893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University