View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10716_high_22 (Length: 202)
Name: NF10716_high_22
Description: NF10716
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10716_high_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 156; Significance: 4e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 1 - 183
Target Start/End: Original strand, 52799136 - 52799319
Alignment:
| Q |
1 |
aaaaaatg-tacatctagaccaacacgacacaatcgccatgtttagcaatccacaaagaacccctctcaactaataactttcatctccactttgcaaaaa |
99 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52799136 |
aaaaaatgatacatctagaccaacacgacacaatcaccatgtttagcaatccacaaagaacccctctcaactaataactttcatctccactttgcaaaaa |
52799235 |
T |
 |
| Q |
100 |
gagctagattcatgaaccccaaatctctaatacctagccctccatctttttccggcttacacgtttgctcccacttcacccaac |
183 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||||||||| ||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
52799236 |
gagctagattcatgaaccctaaatctgtaatacctagcccttcatctttttccggcttacacgtttgctcccacttcgcccaac |
52799319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University