View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10716_low_14 (Length: 254)
Name: NF10716_low_14
Description: NF10716
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10716_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 52798799 - 52798557
Alignment:
| Q |
1 |
tttgtagtttaataaataaatatcaacaccaacctctttcttctatatgattttccacaaatctctcttgatgctctatcaattgttttctccatattaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
52798799 |
tttgtagtttaataaataaatatcaaccctaacctctttcttctatatgattttccacaaatctctcttggtgatctatcaattgttttctccatattaa |
52798700 |
T |
|
| Q |
101 |
taaaaactaagtgtagnnnnnnn-gtccatctgatattgtttcatcacacaccatagcaagtagatagcttccatggtcgatctctctaacataaaatca |
199 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52798699 |
taaaaactaagtgtagtattttttgtccatctgatatcgtttcatcacacgctatagcaagtagatagcttccatggtcgatctctctaacataaaatca |
52798600 |
T |
|
| Q |
200 |
aattggttttcaataacttgagtctattttcttagtctctgct |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52798599 |
aattggttttcaataacttgagtctattttcttagtctctgct |
52798557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 158 - 207
Target Start/End: Original strand, 50630446 - 50630495
Alignment:
| Q |
158 |
aagtagatagcttccatggtcgatctctctaacataaaatcaaattggtt |
207 |
Q |
| |
|
|||||||| |||||||||||||| ||| | | |||||||||||||||||| |
|
|
| T |
50630446 |
aagtagattgcttccatggtcgacctcgcaagcataaaatcaaattggtt |
50630495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 190 - 237
Target Start/End: Complemental strand, 13148445 - 13148398
Alignment:
| Q |
190 |
cataaaatcaaattggttttcaataacttgagtctattttcttagtct |
237 |
Q |
| |
|
|||||||||||||||||| || |||||| |||||| |||||||||||| |
|
|
| T |
13148445 |
cataaaatcaaattggttatcgataactcgagtctcttttcttagtct |
13148398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 190 - 238
Target Start/End: Complemental strand, 20499232 - 20499184
Alignment:
| Q |
190 |
cataaaatcaaattggttttcaataacttgagtctattttcttagtctc |
238 |
Q |
| |
|
||||||| |||||||||| ||||||||||| | ||||||||||||||| |
|
|
| T |
20499232 |
cataaaaccaaattggttatcaataacttgcgcttattttcttagtctc |
20499184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University