View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10716_low_6 (Length: 352)
Name: NF10716_low_6
Description: NF10716
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10716_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 26 - 330
Target Start/End: Complemental strand, 52799122 - 52798816
Alignment:
| Q |
26 |
ttttgtaaaatgaattgtatcgcgttggtggaaggacttaagttgtg--tgtgatgaaggattgtgaaggcggttcactccaaatttcgatttttaggaa |
123 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
52799122 |
ttttgtaaaatgaattgtgccgtgttggtggaaggacttaagttgtgggtgtggtgaaggattgtgaaggcggttcactccaaattttaatttttaggaa |
52799023 |
T |
 |
| Q |
124 |
gcttgggaataagatggctatccaattttaggaagattttgtgttgcatcatgctaagagacgaggtggtcgtcttggtggacttggacctgattccttt |
223 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
52799022 |
gcttgggaataagatgactatccaattttaggaagattttgtgttgcatcatgctaagagacgaggtggtcgccttggtggacttggacctgattccttt |
52798923 |
T |
 |
| Q |
224 |
attgtacattcatgccatatttttaatgagctttgttattggacaacacatagaataattgagtcggctctctttatacccgtaacataacaagtatcat |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
52798922 |
attgtacattcatgccatatttttaatgagctttgttattggacaacacatagaataattgagtcggccctctttatacccgtaacataacaagtatcat |
52798823 |
T |
 |
| Q |
324 |
ttgtact |
330 |
Q |
| |
|
||||||| |
|
|
| T |
52798822 |
ttgtact |
52798816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University