View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10717_high_4 (Length: 249)
Name: NF10717_high_4
Description: NF10717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10717_high_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 32478919 - 32479157
Alignment:
| Q |
1 |
tttcggttttgtcaactttgtgatctagttgtttcattgctttgttgttgtgttggacaattttgtttcattgattcgggttagtagtgtaatttaaccg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32478919 |
tttcggttttgtcaactttgtgatctagttgtttcattgctttgttgttgtgttggacaattttgtttcattgattcgggttagtagtgtaatttaaccg |
32479018 |
T |
 |
| Q |
101 |
cactagtttgtagttaacttgaaattcaacatgctgaagtaacatagttgttgttgagttaaggaaaattggttggagatttaacgatcatagagataaa |
200 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32479019 |
caatagtttgtagttaacttgaaattcaacatgctgaagtatc--agttgttgttgagttaaggaaaattggttggagatttaacgatcatagagataaa |
32479116 |
T |
 |
| Q |
201 |
tacagggatagaaacaatgc-tttatatgtttgaacctttg |
240 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
32479117 |
tacagggatagaaacaatgcttttatatgttggaacctttg |
32479157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University