View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10717_low_11 (Length: 206)
Name: NF10717_low_11
Description: NF10717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10717_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 15 - 189
Target Start/End: Original strand, 52344117 - 52344291
Alignment:
| Q |
15 |
agagacggtattgggacacatatcctccaattgagatttgatgtcatctattaactcaaaacctcttagcgaatttgcatttggaaatgcgttcttctct |
114 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52344117 |
agagacagtattgggacacatatcctccaattgagatttgatgtcatctattaactcaaaacctcttagcgaatttgcatttggaaatgcgttcttctct |
52344216 |
T |
|
| Q |
115 |
cctgtgaaatttgatgtgtcgtctaacaatgctgatgcatcacatccctgcatgtatgtgtatagtacatgatat |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52344217 |
cctgtgaaatttgatgtgtcgtctaacaatgctgatgcatcacatccctgcatgtatgtgtatagtacatgatat |
52344291 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 58; Significance: 1e-24; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 39 - 168
Target Start/End: Original strand, 9155556 - 9155685
Alignment:
| Q |
39 |
ctccaattgagatttgatgtcatctattaactcaaaacctcttagcgaatttgcatttggaaatgcgttcttctctcctgtgaaatttgatgtgtcgtct |
138 |
Q |
| |
|
||||||| |||||||||||| || ||||||||||||||||||||||| ||||| ||| | || | |||||||| ||| ||||| |||| ||||||||| |
|
|
| T |
9155556 |
ctccaatgtagatttgatgtcgtcaattaactcaaaacctcttagcgagtttgcgttttgtaaagaattcttctcacctttgaaacttgacgtgtcgtct |
9155655 |
T |
|
| Q |
139 |
aacaatgctgatgcatcacatccctgcatg |
168 |
Q |
| |
|
| |||| ||||| ||||||||||||||||| |
|
|
| T |
9155656 |
agcaatactgatccatcacatccctgcatg |
9155685 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 118 - 163
Target Start/End: Complemental strand, 26960917 - 26960872
Alignment:
| Q |
118 |
gtgaaatttgatgtgtcgtctaacaatgctgatgcatcacatccct |
163 |
Q |
| |
|
|||||| ||||||| |||||||||| | |||||||||||||||||| |
|
|
| T |
26960917 |
gtgaaacttgatgtatcgtctaacagtactgatgcatcacatccct |
26960872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 166
Target Start/End: Complemental strand, 27202151 - 27202093
Alignment:
| Q |
108 |
cttctctcctgtgaaatttgatgtgtcgtctaacaatgctgatgcatcacatccctgca |
166 |
Q |
| |
|
||||||||| ||||| |||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
27202151 |
cttctctccggtgaagcttgaagtgtcgtctaacaggactgatgcatcacatccctgca |
27202093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University