View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10717_low_5 (Length: 250)
Name: NF10717_low_5
Description: NF10717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10717_low_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 5 - 240
Target Start/End: Original strand, 42061397 - 42061632
Alignment:
| Q |
5 |
actaaagatggaatcatagaactaatacattgcaaactatttttggtaatgttgaggacaaagcttggagtagttgatggattggattgatgctagctct |
104 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
42061397 |
actaaagatggaatcataaaactaatgcattgcaaactgtttttggtaatgttgaggacaaagcttggagtagttgatggattaaattgatgctagctct |
42061496 |
T |
|
| Q |
105 |
tgtaaactgattttggtaatgcacattttaagggagggacggttaggtattagaacttattacttgagttattttgtgtgttttagacttagtttgcatt |
204 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
42061497 |
tgtaaactggttttggtaatgcacattttaagggagggacggttaggtattagaacttattacttgagttgttttgtgtgttttagacttagtttgcatt |
42061596 |
T |
|
| Q |
205 |
gcttacttgtaaagcaagctagcttttagtcctttg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
42061597 |
gcttacttgtaaagcaagctagcttttagtcctttg |
42061632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 146 - 225
Target Start/End: Original strand, 34724609 - 34724688
Alignment:
| Q |
146 |
gttaggtattagaacttattacttgagttattttgtgtgttttagacttagttt-gcattgcttacttgtaaagcaagcta |
225 |
Q |
| |
|
||||||| ||||| |||||||||| || || |||||| || ||||| ||||||| |||||| ||||||||||||||||||| |
|
|
| T |
34724609 |
gttaggtgttagagcttattacttaagctactttgtgagtattagagttagttttgcattg-ttacttgtaaagcaagcta |
34724688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 193 - 227
Target Start/End: Original strand, 28106293 - 28106327
Alignment:
| Q |
193 |
ttagtttgcattgcttacttgtaaagcaagctagc |
227 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |
|
|
| T |
28106293 |
ttagtttgcgttgcttacttgtaaagcaagctagc |
28106327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University