View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10717_low_8 (Length: 237)
Name: NF10717_low_8
Description: NF10717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10717_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 1 - 119
Target Start/End: Original strand, 48369590 - 48369706
Alignment:
| Q |
1 |
tggcacatgattaatctttattttgatcaaccttcccttcccacaaaacccacttacttgtcatgaaataatgaatgttaattgtgtgagactaacttct |
100 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48369590 |
tggcacatgattaatct--attttgatcaaccttcccttcccacaaaacccacttacttgtcatgaaataatgaatgttaattgtgtgagactaacttct |
48369687 |
T |
 |
| Q |
101 |
aagatacttaagaatgtac |
119 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
48369688 |
aagatacttaagaatgtac |
48369706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 186 - 224
Target Start/End: Original strand, 48369773 - 48369811
Alignment:
| Q |
186 |
tgttgttttggcggaggtaagcaaggctaagtatgttgt |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
48369773 |
tgttgttttggcggaggtaagcaaggctaagtgtgttgt |
48369811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University