View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10718_high_4 (Length: 202)
Name: NF10718_high_4
Description: NF10718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10718_high_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 17 - 187
Target Start/End: Complemental strand, 6485926 - 6485756
Alignment:
| Q |
17 |
cagtttcatgcctaagcctttctccagacaaaacctacctctactctgcttcatgggacagaaccgtcaaagtttggagaatcgccgattcaaagtgctt |
116 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6485926 |
cagtttcatgcctaagtctttctccagacaaaacctacctctactctgcttcatgggacagaaccgtcaaagtttggagaatcgccgattcaaagtgctt |
6485827 |
T |
 |
| Q |
117 |
ggaatccattacttcccatgaggatgcagttaacgccgtcgtttgtggaaacgacggaattgttttctctg |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6485826 |
ggaatccattacttcccatgaggatgcagttaacgccgtcgtttgtggaaacgacggaattgttttctctg |
6485756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University