View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10718_low_17 (Length: 248)
Name: NF10718_low_17
Description: NF10718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10718_low_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 5 - 231
Target Start/End: Original strand, 35646298 - 35646530
Alignment:
| Q |
5 |
atgaagtttccatgactcggttcaatttagttttctaccagaaacaatggaacataattggcccatctctatgtagctaggaagatttgtcaggtgtgtg |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
35646298 |
atgaagtttccatgactcggttcaatttagttttctacaagaaacaatggaacataattggcccatctctgtgtagctaggaagatttgtcaggtgtgtg |
35646397 |
T |
|
| Q |
105 |
caaactcagttacaattcatgatcttaatgaaaaaactt------attaagattagagctttttgaaagatatccttgaggatcttggctttcctatgcc |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
35646398 |
caaactcagttacaattcatgatcttaatgaaaaagcttatgatcattaagattagagctttttgaaagatatccttgaggaacttggctttcctatgcc |
35646497 |
T |
|
| Q |
199 |
tttcattgatcttatctggcaatgcctatcctc |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
35646498 |
tttcattgatcttatctggcaatgcctatcctc |
35646530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University