View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10718_low_23 (Length: 202)

Name: NF10718_low_23
Description: NF10718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10718_low_23
NF10718_low_23
[»] chr1 (1 HSPs)
chr1 (17-187)||(6485756-6485926)


Alignment Details
Target: chr1 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 17 - 187
Target Start/End: Complemental strand, 6485926 - 6485756
Alignment:
17 cagtttcatgcctaagcctttctccagacaaaacctacctctactctgcttcatgggacagaaccgtcaaagtttggagaatcgccgattcaaagtgctt 116  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6485926 cagtttcatgcctaagtctttctccagacaaaacctacctctactctgcttcatgggacagaaccgtcaaagtttggagaatcgccgattcaaagtgctt 6485827  T
117 ggaatccattacttcccatgaggatgcagttaacgccgtcgtttgtggaaacgacggaattgttttctctg 187  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6485826 ggaatccattacttcccatgaggatgcagttaacgccgtcgtttgtggaaacgacggaattgttttctctg 6485756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University