View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10719_high_11 (Length: 249)

Name: NF10719_high_11
Description: NF10719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10719_high_11
NF10719_high_11
[»] chr1 (2 HSPs)
chr1 (19-236)||(3429187-3429404)
chr1 (20-236)||(3425708-3425924)


Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 19 - 236
Target Start/End: Complemental strand, 3429404 - 3429187
Alignment:
19 cccatatctctttggaggactagcagccattatgggactcatagccttggcgttgttggcactagcatgctctttttgtaaactctcaaggaacaaccaa 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3429404 cccatatctctttggaggactagcagccattatgggactcatagccttggcgttgttggcactagcatgctctttttgtaaactctcaaggaacaaccaa 3429305  T
119 gatggggaccacaatgacttggacaacatagagagtgaccctcaaactaaggaacccatcaagtcctacgaagagaaggtccttgtaattatggctggga 218  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3429304 gatggggaccacaatgacttggacaacaaagagagtgaccctcaaactaaggaacccatcaagtcctacgaagagaaggtccttgtaattatggctggga 3429205  T
219 atgagaaaccaacattct 236  Q
    ||||||||||||||||||    
3429204 atgagaaaccaacattct 3429187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 20 - 236
Target Start/End: Complemental strand, 3425924 - 3425708
Alignment:
20 ccatatctctttggaggactagcagccattatgggactcatagccttggcgttgttggcactagcatgctctttttgtaaactctcaaggaacaaccaag 119  Q
    ||||||||||||||||||||||| || ||||| || ||||||||||||||||| |||| |||||||||||| | ||||| |||||||||| |||||||||    
3425924 ccatatctctttggaggactagctgctattataggtctcatagccttggcgttattggtactagcatgctcatattgtagactctcaagggacaaccaag 3425825  T
120 atggggaccacaatgacttggacaacatagagagtgaccctcaaactaaggaacccatcaagtcctacgaagagaaggtccttgtaattatggctgggaa 219  Q
    ||| ||| || | ||  |||||||||| ||| |||||||||||||||||| ||||  |||||   || ||||||||  ||||||| ||||||||||| ||    
3425824 atgaggatcatagtgctttggacaacaaagaaagtgaccctcaaactaagaaacctgtcaaggtttatgaagagaatatccttgtcattatggctggtaa 3425725  T
220 tgagaaaccaacattct 236  Q
    |||||| ||||||||||    
3425724 tgagaacccaacattct 3425708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University