View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10719_high_14 (Length: 239)

Name: NF10719_high_14
Description: NF10719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10719_high_14
NF10719_high_14
[»] chr2 (2 HSPs)
chr2 (151-224)||(6667673-6667746)
chr2 (1-77)||(6667576-6667652)


Alignment Details
Target: chr2 (Bit Score: 74; Significance: 4e-34; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 151 - 224
Target Start/End: Original strand, 6667673 - 6667746
Alignment:
151 ttatgctaacaacttgctttgccttttcccttcaccaatttggctcacttttacccttcccgtaatttcttatt 224  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6667673 ttatgctaacaacttgctttgccttttcccttcaccaatttggctcacttttacccttcccgtaatttcttatt 6667746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 1 - 77
Target Start/End: Original strand, 6667576 - 6667652
Alignment:
1 ttccactttagctttcccacacaaataattatttccaacatacctctcttcgtgttttccatgcaaatgaatatcca 77  Q
    |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
6667576 ttccactttagctttcccacacaaataactatttccaacatacctctcttcgtgttttccatgcaaatgaatatcca 6667652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University