View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10719_high_14 (Length: 239)
Name: NF10719_high_14
Description: NF10719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10719_high_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 74; Significance: 4e-34; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 151 - 224
Target Start/End: Original strand, 6667673 - 6667746
Alignment:
| Q |
151 |
ttatgctaacaacttgctttgccttttcccttcaccaatttggctcacttttacccttcccgtaatttcttatt |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6667673 |
ttatgctaacaacttgctttgccttttcccttcaccaatttggctcacttttacccttcccgtaatttcttatt |
6667746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 1 - 77
Target Start/End: Original strand, 6667576 - 6667652
Alignment:
| Q |
1 |
ttccactttagctttcccacacaaataattatttccaacatacctctcttcgtgttttccatgcaaatgaatatcca |
77 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6667576 |
ttccactttagctttcccacacaaataactatttccaacatacctctcttcgtgttttccatgcaaatgaatatcca |
6667652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University