View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10719_low_10 (Length: 368)
Name: NF10719_low_10
Description: NF10719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10719_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 275; Significance: 1e-154; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 26 - 315
Target Start/End: Original strand, 23598038 - 23598328
Alignment:
| Q |
26 |
tttaatgttaacaatggtttatgttcctgttcttcatttttcttgttttgacttttgataaattgatcatggattcaaattcgtgttt-atctttctaag |
124 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
23598038 |
tttaatgttaacaatggtttaagttcctgttcttcatttttcttgttttgacttttgataaattgatcatggattcaaattcgtgttttatctttctaag |
23598137 |
T |
|
| Q |
125 |
ttgggtagtttttgttaggattataatcggttaagaaatttgaagtgaatagacttcttcaattttggttttggtttggcttttaaaactgtagcaggtt |
224 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23598138 |
ttgggtagtttttgttaggattataatcagttaagaaatttgaagtgaatagacttcttcaattttggttttggtttggcttttaaaactgtagcaggtt |
23598237 |
T |
|
| Q |
225 |
ggtgttcgagggcatactagaaaaagattaaaaaatggctcaattgactttgttggttttggtttggcttttgaaactgtatcaggttggt |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23598238 |
ggtgttcgagggcatactagaaaaagattaaaaaatggctcaattgactttgttggttttggtttggcttttgaaactgtatcaggttggt |
23598328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 316 - 352
Target Start/End: Original strand, 23598358 - 23598394
Alignment:
| Q |
316 |
tccattgacttaggtttgtctttagtttgaaggatgt |
352 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
23598358 |
tccattgactttggtttgtctttagtttgaaggatgt |
23598394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University