View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10719_low_13 (Length: 340)
Name: NF10719_low_13
Description: NF10719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10719_low_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 14 - 330
Target Start/End: Original strand, 32505151 - 32505471
Alignment:
| Q |
14 |
ctttatcatgcatgattcctcaatggttaaaaaatttcatagctgaattactttaattgtgctaagatcaagaacaatgtgaatggtttgacaattgggt |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32505151 |
ctttatcatgcatgattcctcaatggttaaaaaatttcaaagctgaattactttaattgtgctaagatcaagaacaatgtgaatggtttgacaattgggt |
32505250 |
T |
|
| Q |
114 |
ggggcagatgacatttgaagggtggtacgtatgagttctgcttacgactcgacaagacattgattttgtttctctctgtacatttacgtgtactgctaac |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32505251 |
ggggcagatgacatttgaagggtggtacgtatgagttctgcttaggactcgacaagacattgattttgtttctctctgtacatttacgtgtactgctaac |
32505350 |
T |
|
| Q |
214 |
cttcactgcccaattgccaacaaagtttttcattcatggggtcatgggaccatga----catgttttcatttattagtgttcatccgaacataattaaac |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
32505351 |
cttcactgcccaattgccaacaaagtttttcattcatggggtcatgggaccatgacatgcatgttttcatttattagtgttcatcccaacataattaaac |
32505450 |
T |
|
| Q |
310 |
aacaaattccccttacctatg |
330 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
32505451 |
aacaaattccccttacctatg |
32505471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University