View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10719_low_14 (Length: 340)
Name: NF10719_low_14
Description: NF10719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10719_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 166; Significance: 8e-89; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 166; E-Value: 8e-89
Query Start/End: Original strand, 18 - 187
Target Start/End: Original strand, 54276289 - 54276458
Alignment:
| Q |
18 |
gaaaatgtgtcttgtgtttagaatgtctatgtaatgtgaagcttagaatgggatcttgcacacaaatactcaatcaccgttgctgtaattttggttttca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54276289 |
gaaaatgtgtcttgtgtttagaatgtctatgtaatgtgaagcttagaatgggatcttgcacacaaatactcaatcaccgttgctgtaattttggttttca |
54276388 |
T |
|
| Q |
118 |
gattgtttgcttgcttgttctccaattggatgtcaaaaacatacttaaagttaaagactactcaactcac |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54276389 |
gattgtttgcttgcttgttctccaattggatatcaaaaacatacttaaagttaaagactactcaactcac |
54276458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 236 - 333
Target Start/End: Original strand, 54276507 - 54276604
Alignment:
| Q |
236 |
tccaacaaacgttcctttaaagcaatatctaaaacacaacctatatatactactccctttgcacattctttctcatcccttctcttatattcttctct |
333 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54276507 |
tccaacaaacgttcctttaaagcaatatctaaaacacaacctatatatactactccctttgcacattctttctcatcccttctcttatattcttctct |
54276604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University