View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10719_low_22 (Length: 284)
Name: NF10719_low_22
Description: NF10719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10719_low_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 21 - 274
Target Start/End: Original strand, 31448726 - 31448979
Alignment:
| Q |
21 |
gttggaagtgagaatcactgcagtggaggactccttgcgacaaacaatggatgaattctgtcaaatcataacaatggagtttgcaaaactgttggatcga |
120 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
31448726 |
gttggatgtgagaatcactgcagtggaggactccttgcgacaaacaatggatgaattctgtcaaatcataacaacggagtttgcaaaactgttggatcga |
31448825 |
T |
|
| Q |
121 |
cgctcttcgggaggtgttcactcatcctcatacaccgaggattcggtttgattccaagttgattatgagaaggaagtagatccagagggaaatgagtctg |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31448826 |
cgctcttcgggaggtgttcactcatcctcatacaccgaggattcggtttgagtacaagttgattatgagaaggaagtagatccagagggaaatgagtctg |
31448925 |
T |
|
| Q |
221 |
aggctcaaattatcgtaacatgtatcgtagctatagaagaagtggtaccctttg |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
31448926 |
aggctcaaattatcgtaacatgtatcgtagctatagaagaagtggtaccgtttg |
31448979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University