View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10719_low_23 (Length: 278)
Name: NF10719_low_23
Description: NF10719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10719_low_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 1 - 271
Target Start/End: Complemental strand, 6703867 - 6703593
Alignment:
| Q |
1 |
ctcattattacttaataaaggtttgaatccttacaagaaacggggtagcatatacattggatctttaaataatcatgcatgctctta---agatatctat |
97 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
6703867 |
ctcataattacttaataaaggtttgaatccttacaagaaacggggtagcatatacattggatctttaaataatcatgcatgctcttaattagatatctat |
6703768 |
T |
 |
| Q |
98 |
agctagatctgacctaggataaaatttctaag-nnnnnnnaacaatgattagatgctaacttttcattttcatttagcttatgctaccataggtttagct |
196 |
Q |
| |
|
||||||||||||||||||||||||| |||| | ||||||||||||||| |||||| ||||||| |||||| | |||||||||||| ||||||| |
|
|
| T |
6703767 |
agctagatctgacctaggataaaatatctacgttttttttaacaatgattagatgataacttatcatttttatttagatgatgctaccatagatttagct |
6703668 |
T |
 |
| Q |
197 |
tttcttgttccatatatctgagatagtttaggtcttgttctcttgttctccccatttgcacaatcgttcttctct |
271 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
6703667 |
tttcttgttccatatatctgagataagttaggtcttgttctcttgttctccccatttgcaccatccttcttctct |
6703593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University