View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10719_low_24 (Length: 272)
Name: NF10719_low_24
Description: NF10719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10719_low_24 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 17 - 258
Target Start/End: Complemental strand, 6704251 - 6704009
Alignment:
| Q |
17 |
atttctaaccaaattacatgataggagatgttcttcctttcatcaattcttgaaacatctcagcacaaaaacaatacacaattcaatacactcttttata |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||| ||||||||||||||| |
|
|
| T |
6704251 |
atttctaaccaaattacatgataggagatgttcttcctttcatcaattcttgaaacatctcagcacacaaacattacacaattcgatacactcttttata |
6704152 |
T |
|
| Q |
117 |
ctatgtctaagcatacatatatatgtgcatgttttagtcgaaagttaatgattt-aaagtacatatcaaactatattgttgtatttgcattggttggtga |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
6704151 |
ctatgtctaagcatacatatatatgtgcatgttttagtcgaaagttaatgatttaaaagtacatatcaaactatattgttgtatttacattggttggtga |
6704052 |
T |
|
| Q |
216 |
tttatgtgtactttacttttacatacaaattaatcgtcatatt |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
6704051 |
tttatgtgtactttacttttacatacaaattaatcatcatatt |
6704009 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University