View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10719_low_25 (Length: 269)
Name: NF10719_low_25
Description: NF10719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10719_low_25 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 256
Target Start/End: Original strand, 907718 - 907974
Alignment:
| Q |
1 |
tcatcatattatttacattctttgattcttcgatggccacaacaatgtgatcagatttattaggtaatgtacgcgtaatcttttccactatcatacaatc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
907718 |
tcatcatattatttacattctttgattcttcgatggccacagcaatgtgatcagatttattaggtaatgtacgcgcaatcttttccactatcatacaatc |
907817 |
T |
|
| Q |
101 |
agtgatggccaatattcatgtgaaat-ggttgatgcattttatgctgcctccatctgcaacaactcaagttgtctccgtatagattgtagtttcacttac |
199 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
907818 |
agtgatggccaatattcatgtgaaataggttgatgcattttatgctgcctccatctgcaacaactcaagttgtctccgtatagattgtagtttcacttac |
907917 |
T |
|
| Q |
200 |
nnnnnnnnaccttttctccgccaatgcagtactttgcaagagaatctcaagcctcct |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
907918 |
ttttttttaccttttctccgccaatgcagtactttgcaagagaatctcaagcctcct |
907974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University