View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10719_low_27 (Length: 250)
Name: NF10719_low_27
Description: NF10719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10719_low_27 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 246
Target Start/End: Complemental strand, 21928878 - 21928630
Alignment:
| Q |
1 |
aatttaacaattcaaagttattgtactatttaataaagtttaaataattaagatggaataatttacacataccggaaataaagatagtttagtgatgagg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21928878 |
aatttaacaattcaaagttattgtactatttaaaaaagttgaaataattaagatggaataatttacacataccggaaataaagatagtttagtgatgagg |
21928779 |
T |
|
| Q |
101 |
ttaatgctcaatttgtatggaaattg---taagataggaaacttatgtgtattgatagagaatggtcccatcctgttatatctttaaagtctatttattg |
197 |
Q |
| |
|
|||||||| |||||||||||||| | ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21928778 |
ttaatgctgaatttgtatggaaaatagtataagataggaaacttgtgtgtattgatagagaatggtcccatcctgttatatctttaaagtctatttattg |
21928679 |
T |
|
| Q |
198 |
tttactgaaattgtcctttattcgtcaatctcgagtgttcttctctctc |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
21928678 |
tttactgaaattgtcctttattcgtcaatctcgagtgttcttttctctc |
21928630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University