View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10719_low_28 (Length: 250)
Name: NF10719_low_28
Description: NF10719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10719_low_28 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 59; Significance: 4e-25; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 168 - 242
Target Start/End: Complemental strand, 26609348 - 26609274
Alignment:
| Q |
168 |
gttattgtaatgaaataatttaatccttaaattggtgattaattaatgatttaactaaatgcagggtcctttgct |
242 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| ||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
26609348 |
gttattgtaatgaaatgatttaatccttaaattggtggttaattaatgatttaaccaaatgtagggtcctttgct |
26609274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 64 - 138
Target Start/End: Complemental strand, 26609486 - 26609413
Alignment:
| Q |
64 |
taaatgtgttagaaaattacattctgaaatccaaatttagatgatagttggtgacaaaaggccatctagaaggtt |
138 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
26609486 |
taaatgtgtta-aaaattacagtctgaaatccaaatttagatgatagttgatgacaaaaggccatctagaaggtt |
26609413 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University