View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10719_low_29 (Length: 249)
Name: NF10719_low_29
Description: NF10719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10719_low_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 19 - 236
Target Start/End: Complemental strand, 3429404 - 3429187
Alignment:
| Q |
19 |
cccatatctctttggaggactagcagccattatgggactcatagccttggcgttgttggcactagcatgctctttttgtaaactctcaaggaacaaccaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3429404 |
cccatatctctttggaggactagcagccattatgggactcatagccttggcgttgttggcactagcatgctctttttgtaaactctcaaggaacaaccaa |
3429305 |
T |
 |
| Q |
119 |
gatggggaccacaatgacttggacaacatagagagtgaccctcaaactaaggaacccatcaagtcctacgaagagaaggtccttgtaattatggctggga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3429304 |
gatggggaccacaatgacttggacaacaaagagagtgaccctcaaactaaggaacccatcaagtcctacgaagagaaggtccttgtaattatggctggga |
3429205 |
T |
 |
| Q |
219 |
atgagaaaccaacattct |
236 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
3429204 |
atgagaaaccaacattct |
3429187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 20 - 236
Target Start/End: Complemental strand, 3425924 - 3425708
Alignment:
| Q |
20 |
ccatatctctttggaggactagcagccattatgggactcatagccttggcgttgttggcactagcatgctctttttgtaaactctcaaggaacaaccaag |
119 |
Q |
| |
|
||||||||||||||||||||||| || ||||| || ||||||||||||||||| |||| |||||||||||| | ||||| |||||||||| ||||||||| |
|
|
| T |
3425924 |
ccatatctctttggaggactagctgctattataggtctcatagccttggcgttattggtactagcatgctcatattgtagactctcaagggacaaccaag |
3425825 |
T |
 |
| Q |
120 |
atggggaccacaatgacttggacaacatagagagtgaccctcaaactaaggaacccatcaagtcctacgaagagaaggtccttgtaattatggctgggaa |
219 |
Q |
| |
|
||| ||| || | || |||||||||| ||| |||||||||||||||||| |||| ||||| || |||||||| ||||||| ||||||||||| || |
|
|
| T |
3425824 |
atgaggatcatagtgctttggacaacaaagaaagtgaccctcaaactaagaaacctgtcaaggtttatgaagagaatatccttgtcattatggctggtaa |
3425725 |
T |
 |
| Q |
220 |
tgagaaaccaacattct |
236 |
Q |
| |
|
|||||| |||||||||| |
|
|
| T |
3425724 |
tgagaacccaacattct |
3425708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University