View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10719_low_41 (Length: 232)
Name: NF10719_low_41
Description: NF10719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10719_low_41 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 1 - 102
Target Start/End: Original strand, 52734479 - 52734580
Alignment:
| Q |
1 |
ttcattacttttgcaggctaggaatcaaaaggttggggagaaacctcttctctctatttctacattcatgcaggtactatattaatcattcctatggaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
52734479 |
ttcattacttttgcaggctaggaatcaaaaggttggtgataaacctcttctctctatttctacattcatgcaggtactatattaatcatttctatggaat |
52734578 |
T |
|
| Q |
101 |
at |
102 |
Q |
| |
|
|| |
|
|
| T |
52734579 |
at |
52734580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 187 - 220
Target Start/End: Original strand, 52734666 - 52734699
Alignment:
| Q |
187 |
tctcttttaggcagctcgcaacaatgttcttctc |
220 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
52734666 |
tctcttttaggctgctcgcaacaatgttcttctc |
52734699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University