View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10719_low_43 (Length: 231)
Name: NF10719_low_43
Description: NF10719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10719_low_43 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 218; Significance: 1e-120; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 13333345 - 13333566
Alignment:
| Q |
1 |
ttgtgacacaaaaccccttctctgttttccttttaacctttctcttgttaatcaccaatgtcaaatcagactcattttctttcaacttccccaaatttga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13333345 |
ttgtgacacaaaaccccttctctgttttccttttaacctttctcttgttaatcaccaatgtcaaatcagactcattttctttcaacttccccaaatttga |
13333444 |
T |
 |
| Q |
101 |
caccgatactaaaagcatcattattgatggtgatgccaacacaacaaatggagtactacaattaactaaaaaggaccaacttggcaacccatctccacac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13333445 |
caccgatactaaaagcatcattattgatggtgatgccaacacaacgaatggagtactacaattaactaaaaaggaccaacttggcaacccatctccacac |
13333544 |
T |
 |
| Q |
201 |
agttttggcctctccttcttct |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
13333545 |
agttttggcctctccttcttct |
13333566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 45 - 215
Target Start/End: Original strand, 13308233 - 13308403
Alignment:
| Q |
45 |
ttgttaatcaccaatgtcaaatcagactcattttctttcaacttccccaaatttgacaccgatactaaaagcatcattattgatggtgatgccaacacaa |
144 |
Q |
| |
|
|||||||||| ||| ||||| || |||||||| |||||||||||||||||||| || |||||| | || ||| | || || ||||||||||| |||| |
|
|
| T |
13308233 |
ttgttaatcaacaacgtcaagtcggactcattatctttcaacttccccaaattcgataccgatgccctaaacattgtcatcgacggtgatgccaaaacaa |
13308332 |
T |
 |
| Q |
145 |
caaatggagtactacaattaactaaaaaggaccaacttggcaacccatctccacacagttttggcctctcc |
215 |
Q |
| |
|
|| ||||||||||||||| ||||||||||||||| ||||||| ||||||||||| ||| ||||| ||||| |
|
|
| T |
13308333 |
caggtggagtactacaattgactaaaaaggaccaatttggcaatccatctccacatagtgttggcttctcc |
13308403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University