View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10719_low_45 (Length: 227)
Name: NF10719_low_45
Description: NF10719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10719_low_45 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 184; Significance: 1e-99; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 17 - 208
Target Start/End: Complemental strand, 6782457 - 6782266
Alignment:
| Q |
17 |
agatagactaccagaatgtcatagtatgcaggtatgcatcttctttatataacttgagagtattgtatttgaacttgagaagtttgtgtttgtggcaatt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6782457 |
agatagactaccagaatgtcatagtatgtaggtatgcatcttctttatataacttgagagtattgtatttgaacttgagaagtttgtgtttgtggcaatt |
6782358 |
T |
|
| Q |
117 |
taaattcggatatataaaataaagtaccagtgctgggattcaaccgattgtttgaagaggtagggaggtccgcctgttttggcggggtgggg |
208 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6782357 |
taaattcggatatataaaataaagtagcagtgctgggattcaaccgattgtttgaagaggtagggaggtccgcctgttttggcggggtgggg |
6782266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 133 - 203
Target Start/End: Complemental strand, 3108264 - 3108194
Alignment:
| Q |
133 |
aaataaagtaccagtgctgggattcaaccgattgtttgaagaggtagggaggtccgcctgttttggcgggg |
203 |
Q |
| |
|
|||||||||| |||||||||||| | | ||||||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
3108264 |
aaataaagtagcagtgctgggatccgatcgattgtttgaagaggtggggaggtccacctgttttggcgggg |
3108194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 40 - 97
Target Start/End: Complemental strand, 3108410 - 3108355
Alignment:
| Q |
40 |
gtatgcaggtatgcatcttctttatataacttgagagtattgtatttgaacttgagaa |
97 |
Q |
| |
|
||||| |||| ||||||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
3108410 |
gtatgtaggtgtgcatcttctttatataacatgag--tattgtatttgaacttgagaa |
3108355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 25 - 65
Target Start/End: Original strand, 51284109 - 51284149
Alignment:
| Q |
25 |
taccagaatgtcatagtatgcaggtatgcatcttctttata |
65 |
Q |
| |
|
|||||||||||||| ||||| ||||||| |||||||||||| |
|
|
| T |
51284109 |
taccagaatgtcattgtatgtaggtatgtatcttctttata |
51284149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University